Samba In The World Of NGS
Today I was reading a publication about sequencing error profiles in Ion torrent PGM data, when I came upon a detail in the PGM sequencing workflow that I find funny and interesting at the same time and that I want to share with you.
You may know that the sequencing method of the Ion Torrent PGM is quite similar to the sequencing method of the Roche 454 devices. In both technologies beads that hold the clonally amplified template with appropriate sequencing adaptors are loaded onto a plate with millions of wells. The loading is performed in a way that ensures that most wells are loaded with a single bead (the size of the wells do not allow two beads per well). In a next step dNTPs are flowed over the surface in a predetermined order with only one type of nucleotide at a time. Washing steps occur before the next dNTP is flowed over the surface. The way the incorporation of the nucleotide is measured represents the substantial difference between both technologies:
With the Roche 454 technology an enzymatic cascade follows the polymerization event that finally generates pyrophosphate and light. The light intensity is proportional to the number of nucleotides that were incorporated (if any). The light is detected by the camera of the system.
In contrast, the Ion torrent PGM is measuring pH rather than light to detect incorporation events. A single proton is released for every dNTP incorporated during the flow, which changes the net pH value in the respective well and a ionic sensor measures the pH change.
The Roche system (as well as the first generation of the PGM) cycles the 4 dNTPs in a step-wise fashion. They simply repeat the sequence TACG over and over. With the second generation PGM these 4 base cycles have been changed to 32 base cycles (TACGTACGTCTGAGCATCGATCGATGTACAGC), called the Samba sequence. The sequence starts with the same 4-nucleotide repeats, but after 2 such patterns some nucleotides are repeated in a period shorter than four. According to Bragg et al. this modification was implemented to improve the synchrony of clonal templates which facilitates a more accurate base calling. Unfortunately the Samba sequence is not optimized for read length as the original sequence was. It remains to be seen if Ion Torrent (now owned by Thermo Fisher) will make further modifications in the Samba sequence in order to balance the accuracy and the read length of the system.



May 10, 2013 
