Tag Archives: Roche 454

Samba In The World Of NGS

sambaToday I was reading a publication about sequencing error profiles in Ion torrent PGM data, when I came upon a detail in the PGM sequencing workflow that I find funny and interesting at the same time and that I want to share with you.

You may know that the sequencing method of the Ion Torrent PGM is quite similar to the sequencing method of the Roche 454 devices. In both technologies beads that hold the clonally amplified template with appropriate sequencing adaptors are loaded onto a plate with millions of wells. The loading is performed in a way that ensures that most wells are loaded with a single bead (the size of the wells do not allow two beads per well). In a next step dNTPs are flowed over the surface in a predetermined order with only one type of nucleotide at a time. Washing steps occur before the next dNTP is flowed over the surface. The way the incorporation of the nucleotide is measured represents the substantial difference between both technologies:

With the Roche 454 technology an enzymatic cascade follows the polymerization event that finally generates pyrophosphate and light. The light intensity is proportional to the number of nucleotides that were incorporated (if any). The light is detected by the camera of the system.

In contrast, the Ion torrent PGM is measuring pH rather than light to detect incorporation events. A single proton is released for every dNTP incorporated during the flow, which changes the net pH value in the respective well and a ionic sensor measures the pH change.

The Roche system (as well as the first generation of the PGM) cycles the 4 dNTPs in a step-wise fashion. They simply repeat the sequence TACG over and over. With the second generation PGM these 4 base cycles have been changed to 32 base cycles (TACGTACGTCTGAGCATCGATCGATGTACAGC), called the Samba sequence. The sequence starts with the same 4-nucleotide repeats, but after 2 such patterns some nucleotides are repeated in a period shorter than four. According to Bragg et al. this modification was implemented to improve the synchrony of clonal templates which facilitates a more accurate base calling. Unfortunately the Samba sequence is not optimized for read length as the original sequence was. It remains to be seen if Ion Torrent (now owned by Thermo Fisher) will make further modifications in the Samba sequence in order to balance the accuracy and the read length of the system.

Hybrid De Novo Genome Assemblies

What are your intentions when being interested in a bacterial or fungal de novo genome sequencing project?

Typical answers we get from our customers:

  • Easy working with the data
  • Data suitable for high quality annotation
  • Resolution of structural rearrangements
  • High consensus accuracy
  • High cost-efficiency

All these requirements can be fulfilled perfectly when combining Roche GS FLX++ and Illumina data. The long Roche FLX++ reads of up to 1100 bp give much longer contigs than Illumina reads only do. For scaffolding and to be able to resolve structural rearrangements we sequence shotgun (SG) and LJD libraries with Illumina technology. The adding of Illumina reads keeps the overall costs at a reasonable level. Furthermore the reads correct the Roche sequencing errors at homopolymer sites and therefore enable us to build a consensus sequence with high accuracy.

The superiority of such a hybrid assembly becomes quickly apparent when looking at the following results of one of our proof of concept studies. In this de novo project, we sequenced a fungal genome of about 30 Mbp and approx. 57% GC content. Using the hybrid strategy we obtained only 10 chromosome-sized scaffolds (see figure below) with up to 8.3 Mbp. Remarkably, the 10 scaffolds represent the majority of genetic information present, given that they make up 99.6% of all scaffold sequence information.

Such results enable easy data handling and definitely are an excellent starting point for annotation and studying of gene content and rearrangements.

Sequencing strategy: SG library with FLX++ (approx. 10-fold coverage), SG and LJD 3 kbp, 8 kbp and 20 kbp on Illumina HiSeq 2000 with 2x 100 bp module.

 

16S Amplicon Experiments: Which Platform to Choose?

Since 2010 several studies have been published that analyze microbial community composition by amplicon sequencing on the Illumina Genome Analyzer (GA). However, direct adaption of these protocols for sequencing on the HiSeq 2000 – the currently predominant Illumina sequencer – is not possible as both systems use different basecalling pipelines. Therefore amplicon sequencing on Illumina HiSeq 2000 is still left to the very experienced users and only a few publications can be studied on this.

In the meanwhile Illumina has introduced the MiSeq as the optimal platform for this kind of projects. In this context they have published an application note presenting sequencing of the V4 region of 16S rRNA genes on the MiSeq system.

And I totally agree that the MiSeq is a very good tool for these studies. For me, the most important advantages of the MiSeq layout in comparison to the sequencing on Illumina HiSeq 2000 are as follows:

  • Shorter turnaround time: The sequencing run itself takes a bit more than one full day, while a HiSeq 2000 run takes up to 12 days.
  • More informational content: By overlapping two paired end reads of 150 bp, full-length reads of about 250 bp can be generated
  • Potential for even longer reads: Illumina has announced read length of 250 bp for the end of the year. Then reads of up to 450 bp should be possible.

Nevertheless Roche GS FLX+ sequencing is still able to generate much longer reads with an average of up to 500-600 bp. And the long read length will provide a deeper insight into the microbiome of interest or more precisely higher classification efficiency down to species level. However Roche sequencing goes along with higher costs per base, so it will always be a decision based on the individual experiment, whether read length or sequencing depth is the most important factor.