Tag Archives: Ion torrent

Transcriptome assemblers put to the test

Next Generation Sequencing produces millions and billions of reads – and the interpretation of this reads rely on bioinformatic tools.

Especially for de novo assemblies of genomes or transcriptomes the result can vary dependent on the quality of the assembly.

In a recent publication Shorash Amin and his co-workers sequence the transcriptome of the non-model gastropod Nerita melanotragus with the Ion PGM. Afterwards they used different softwares and compared the quality different assemblies of the transcriptome (Amin et. al).

Oases, Trinity, Velvet and Geneious Pro, were the four de novo transcriptome assemblers that were used for this study. The assemblers were compared on different parameters like the length of the contigs, N50 statistics, BLAST and annotation success.

The longest contig was created with the Oasis assembler (1700 bp) and overall Trinity and Oasis delivered much better results than the de novo assembly of Ion PGM reads with Velvet or Geneious Pro.

Furthermore the mapping to a reference genome showed that Ion PGM transcriptome sequencing and subsequent de novo assembly with either Trinity or Oasis generates reliable and accurate results.

Read the complete publication here.

More Updates: Illumina & IonTorrent

Quarter 4 of 2014 seems to be another exciting one for Next Generation Sequencing. Beside the chemistry update for PacBio RSII also Illumina and IonTorrent / ThermoFisher announced two major improvements / achievements:

  • Chemistry update for the Illumina HiSeq X Ten and the HiSeq 2500 Rapid Run
    The new v2 reagent kit for the HiSeq X Ten supports a PCR-free sample preparation kit, which eliminates amplification during the library preparation. So far only sample preparation kits with PCR were possible, which sometimes results in a lower quality of challeging genomic regions.
    The new v2 reagent kit for the HiSeq 2500 enables users to sequence 2x 250 bp and the new chemistry therefore delivers up to 300 Gbp of data in only 60 hours. (Press Release)
    To my opinion Illumina proves once more that NGS is highly dynamic and that their continous update for existing systems is the key for their success (the latest financial report confirms that Q3 of 2014 with a growth of 10% is the strongest since 2011 for Illumina (Fierce Medical Devices)).
  • IonTorrent goes diagnostic
    The Ion PGM Dx System is now also CE-Marked for in vitro diagnostic (IVD) use in Europe. Thermo Fisher Scientific believes that the CE-mark “will enable European clinical laboratories to more easily […] implement new […] diagnostic assays” (Press Release).
    In September they announced already that the PGM is now listed with the U.S. FDA as a Class II Medical Device.
    To my opinion the clearance for diagnostic use in Europe as well as in the U.S. will further strengthen the position of the Ion PGM in clinical laboratories.

NGS Applications – get an insight…

paper_02

You want to know more about projects where your research colleagues used next generation sequencing?

Check out the Nature Reviews overview of interesting publications releated to different applications of next generation sequencing.

All you need to know about NGS

During my research through the web for news in the area of NGS I found this great practical course:

The EMBL-EBI offers a 15h online course that should help every newby and everyone who needs some refreshing information in NGS. And since we have several users of this blog that are new to NGS I thought it would be worth to share this course.

This course is divided into several subunits so everyone can learn in his own speed and in alignment with other tasks that are on everyone’s desk.

 

The key learnings are:

  • Understand some principles behind NGS
  • Know the challenges created by NGS
  • Know how to submit and retrieve NGS data to and from databases
  • Understand the uses of NGS data in: Whole genome assembly; Gene expression analysis; Genome annotation; Gene regulation analysis; Variation studies

Thank you EMBL-EBI for this great summary!

CSP for human exome sequencing with Ion Proton

Ion Proton System  - Front FacingEurofins MWG Operon joined the exclusive certified service provider program from Life Technologies. Using the Ion AmpliSeq Solution for human exome sequencing on Ion Proton offers several advantages:

  • Flexible number of samples: starting from 1 exome up to 96
  • Fast turnaround times: 5-10 workding days
  • High data quality: mean coverage ~ 100x;  mean read length ~ 160 bp
  • Low input material: starting from 250 ng / sample

Learn more about human exome sequencing at Eurofins here.Ion Proton

News From The World Of NGS

Pacific Bioscience’s instrument PacBio RS is known as the third generation sequencing technology. And again they proof their innovative character. During the course of the last couple of months two new chemistry packages have been released (XL & P4). And during the last couple of days two even more interesting news were spread:

1. Roche and PacBio’s signed an agreement for codeveloping diagnostic products for the PacBio RS instrument (Genome Web). From my point of view this is a huge signal. Roche, as an experienced player in the NGS market with its own sequencing instruments see’s a lot of potential in the SMRT technology. So the PacBio RS system obviously got out of the teething phase and will increase its importance in the NGS business in the coming months.

2. And also New England Biolabs a big player in the area of enzyme production, proteomics and drug discovery is using the PacBio RS to study bacterial methylomes and work on new reagents for 5-mc detection. And the CSO from NEB highlights that they have choosen “the PacBio system to study bacterial methylomes because of a unique feature of SMRT sequencing that enables the detection of base modifications through the system’s kinetics”. (Genome Web)

Beside the great news for Pacific Biosciences als Life Technologies or better Thermo Fisher signed a great deal with the Chinese Dx firm iGenomics to install 32 Ion Proton sequences in 2013 (Genome Web).

And clearly all developments focus on Molecular Diagnotics and Clinical Diagnostics. And to add the missing link in this news update also Illumina recently announced that they partner with G3 to identify novel biomarkers and pathways in cardiovascular disease.

Running a NGS Company Is Profitable

A recent article in GEN (Genetic Engineering & Biotechnolgy News) ranked the 2012 salaries of the TOP 20 CEO’s of life sciences tools and technologies providers.

Amongst them: the CEO’s of PacificBiosciences, Illumina, Life Technologies:

Michael W. Hunkapiller, Ph.D. (PacBio) $2,177,002

Jay T. Flatley (Illumina)  $8,171,080

Gregory T. Lucier (LifeTech) $10,268,445

But although this is really impressive, it’s still not outrageous. Imagine being a 28-year old soccer player: you can earn 4times as much as G.T. Lucier … (Forbes)

The complete article can be found here.

Amplicon Sequencing Strategy: What Is Your Technology Of Choice?

amplicon_sequencingWe asked for your favourite technology for amplicon sequencing.

Please find the results here:

  • The majority (41 people) voted for Illumina MiSeq due to the data output
  • 29 prefer Ion Torrent for amplicon sequencing
  • 24 favour Roche 454 because of the long reads
  • 6 people say that classical Sanger sequencing is their technology of choice
  • Just 4 are using other technologies

104 NGS experts took part in the voting.

 

Ion Torrent or Illumina?

If you are choosing between Illumina and Ion Torrent for sequencing of your genome of interest, a study published recently by the Broad Institute (Ross et al 2013 Genome Biology 14:R51) may be of interest to you.

The study compares Illumina MiSeq, Ion Torrent PGM and PacBio on sequencing bias in regions with extreme GS content (<10% and >75%) or long AT dinucleotides in three different bacterial genomes. Relative coverage by each technology is lower in all of these difficult regions, but coverage bias was found to be the most pronounced in Ion Torrent PGM data. PacBio demonstrates the least coverage bias, likely because of its amplication-free protocol, but a much higher error rate than the other two platforms was observed. The results are consistent with an earlier study that also compared those same sequencing platforms (Quail et al 2012 BMC Genomics. 13: 341).

Therefore, depending on the characteristics of your genome of interest, your choice of sequencing platform will influence your downstream analyses.

Samba In The World Of NGS

sambaToday I was reading a publication about sequencing error profiles in Ion torrent PGM data, when I came upon a detail in the PGM sequencing workflow that I find funny and interesting at the same time and that I want to share with you.

You may know that the sequencing method of the Ion Torrent PGM is quite similar to the sequencing method of the Roche 454 devices. In both technologies beads that hold the clonally amplified template with appropriate sequencing adaptors are loaded onto a plate with millions of wells. The loading is performed in a way that ensures that most wells are loaded with a single bead (the size of the wells do not allow two beads per well). In a next step dNTPs are flowed over the surface in a predetermined order with only one type of nucleotide at a time. Washing steps occur before the next dNTP is flowed over the surface. The way the incorporation of the nucleotide is measured represents the substantial difference between both technologies:

With the Roche 454 technology an enzymatic cascade follows the polymerization event that finally generates pyrophosphate and light. The light intensity is proportional to the number of nucleotides that were incorporated (if any). The light is detected by the camera of the system.

In contrast, the Ion torrent PGM is measuring pH rather than light to detect incorporation events. A single proton is released for every dNTP incorporated during the flow, which changes the net pH value in the respective well and a ionic sensor measures the pH change.

The Roche system (as well as the first generation of the PGM) cycles the 4 dNTPs in a step-wise fashion. They simply repeat the sequence TACG over and over. With the second generation PGM these 4 base cycles have been changed to 32 base cycles (TACGTACGTCTGAGCATCGATCGATGTACAGC), called the Samba sequence. The sequence starts with the same 4-nucleotide repeats, but after 2 such patterns some nucleotides are repeated in a period shorter than four. According to Bragg et al. this modification was implemented to improve the synchrony of clonal templates which facilitates a more accurate base calling. Unfortunately the Samba sequence is not optimized for read length as the original sequence was. It remains to be seen if Ion Torrent (now owned by Thermo Fisher) will make further modifications in the Samba sequence in order to balance the accuracy and the read length of the system.